View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2120R-Insertion-9 (Length: 247)
Name: NF2120R-Insertion-9
Description: NF2120R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2120R-Insertion-9 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 9 - 247
Target Start/End: Complemental strand, 12167643 - 12167405
Alignment:
| Q |
9 |
tggtgatccattattctcaactttaagagatccatttttacaagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtact |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167643 |
tggtgatccattattctcaactttaagagatccatttttacaagaacttgatcatataccttcttcttcttacttcaacatcacaagtactactagtact |
12167544 |
T |
|
| Q |
109 |
acttcacctgcttctataattgatgttgcttcttctggtgttaatgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgggat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12167543 |
acttcacctgcttctataattgatgttgcttcttctggtgttagtgttactacttcatcatcttcttctgcttctgtttttgcacttgatgagttgagat |
12167444 |
T |
|
| Q |
209 |
caatatcaagaccatgtaaaaacatattctcaaatatga |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12167443 |
caatatcaagaccatgtaaaaacatattctcaaatatga |
12167405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University