View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_high_14 (Length: 321)
Name: NF21210_high_14
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 192 - 306
Target Start/End: Complemental strand, 21234822 - 21234708
Alignment:
| Q |
192 |
tcgtgcatgccattagtgagagtgtttgtgacatcaagattgtcaaatgttattgtcaacttgttggtcaggatgcatcagatggatatgaatgacttga |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21234822 |
tcgtgcatgccattagtgagagtgtttgtgacatcaagattgtcaaatgttattttcaacttgttggtcaggatgcatcagatgaatatgaatgacttga |
21234723 |
T |
|
| Q |
292 |
gagacaatttattga |
306 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21234722 |
gagacaatttattga |
21234708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University