View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_high_20 (Length: 285)
Name: NF21210_high_20
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_high_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 43 - 263
Target Start/End: Complemental strand, 56165629 - 56165409
Alignment:
| Q |
43 |
ctgaaggaagatgtttacaggctgcaaagtcagtgcaatgtcatgcaagcacatatggaaaagatggttgagaagaagaaaggtttctttaaatggaaga |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165629 |
ctgaaggaagatgtttacaggctgcaaagtcagtgcaatgtcatgcaagcacatatggaaaagatggttgagaagaagaaaggtttctttaaatggaaga |
56165530 |
T |
|
| Q |
143 |
aacttgcttttagtaaaagcattggtggcgagatggagaatgttgaacaacatgaagctgaaactgaatttcgatttggaaggcaaaacacaccaacaga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56165529 |
aacttgcttttagtaaaagcattggtggcgagatggagaatgttgaacaacatgaagctgaaactgaatttcgatttggaaggcaaaacacaccaacaga |
56165430 |
T |
|
| Q |
243 |
cttggtgtaaaccaatatgct |
263 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
56165429 |
cttggtgtaaaccaatatgct |
56165409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 43 - 229
Target Start/End: Complemental strand, 44263891 - 44263708
Alignment:
| Q |
43 |
ctgaaggaagatgtttacaggctgcaaagtcagtgcaatgtcatgcaagcacatatggaaaagatggttgagaagaagaaaggtttctttaaatggaaga |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||| ||||||||||||| ||||||| |||||||||| |
|
|
| T |
44263891 |
ctgaaggaagatgtttacaggctgcagagtcagtgcaatgtcatgcaagcacagatggacaagatggctgagaagaagaaaagtttcttcaaatggaaga |
44263792 |
T |
|
| Q |
143 |
aacttgcttttagtaaaagcattggtggcgagatggagaatgttgaacaacatgaagctgaaactgaatttcgatttggaaggcaaa |
229 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44263791 |
aacttgcttttagtaaaagcat---cggagagatggagaatgttgaacaagatgaagctgaaactgaatttggatttggaaggcaaa |
44263708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 225 - 263
Target Start/End: Complemental strand, 44262911 - 44262873
Alignment:
| Q |
225 |
gcaaaacacaccaacagacttggtgtaaaccaatatgct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262911 |
gcaaaacacaccaacagacttggtgtaaaccaatatgct |
44262873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University