View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_high_30 (Length: 247)
Name: NF21210_high_30
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 50102894 - 50103136
Alignment:
| Q |
1 |
atgttctaccaccaatatcaattgttatggcatttaatgaactgacagcattattgcttatgcagagaggagatatcaaagtacaaggagcttgatccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102894 |
atgttctaccaccaatatcaattgttatggcatttaatgaactgatagcattattgcttatgcagagaggagatatcaaagtacaaggagcttgatccat |
50102993 |
T |
 |
| Q |
101 |
tggatcgtttactactgctaaaagccctctgtgaagttagagctgatgtaatatggcctcctgtttagtttgttcaaatttttgtttctttaatacaggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50102994 |
tggatcgtttactactgctaaaagccctctgtgaagttagagctgatgtaatatggcctcctgtttagtttgttcaaatttttgtttctttaatacaggc |
50103093 |
T |
 |
| Q |
201 |
aataatagttctgctctttattctcctgactatagaataatct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50103094 |
aataatagttctgctctttattctcctgactatagaattatct |
50103136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University