View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_high_32 (Length: 239)
Name: NF21210_high_32
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_high_32 |
 |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0178 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 19 - 224
Target Start/End: Complemental strand, 19037 - 18840
Alignment:
| Q |
19 |
ttcttcaccaatattccaaaaccttcaaattcaataacataataggatcctcccatcctttacaaccacacaaattggggtcacccattacaaccacatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19037 |
ttcttcaccaatattccaaaaccttcaaattcaataacataacaggatcctcccatcctttacaaccacacaaatt-gggtcacccattacaaccacatc |
18939 |
T |
 |
| Q |
119 |
aaagcttcaacaacataatccattatccattgtgatacatatctttttaacataaatgggagtaatgttgttagtcttgcaaactgataaaaatagagag |
218 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18938 |
aaagcttcaacaacata-------atccactgcgatacatatctttttaacataaatgggagtagtgttgttagtcttgcaaactgataaaaatagagag |
18846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University