View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_high_5 (Length: 443)
Name: NF21210_high_5
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 43033900 - 43033576
Alignment:
| Q |
1 |
tgtgggtagactt-ggagaataatcttggagtaatcttaggaaacactttgaggtgtgaagtgaggaattcatgtaaactctctacatgacaaaagaata |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43033900 |
tgtgggtagactttggagaataatcttggagtaatcttaggaaacactttgaggtgtgaagtgaggaattcatgtaaactctctacatgacaaaagaata |
43033801 |
T |
 |
| Q |
100 |
ttagagagactgagaaatcaaaggaagagtgaaaatagagg-tcgaaagagatttagagatttttgttgggctgtttctcaacaatggaaagcaagggac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43033800 |
ttagagagactgagaaatcaaaggaagagtgaaaatagagggtcgaaagggatttagagatttttgttgggctgtttctcaacaatggaaagcaagggac |
43033701 |
T |
 |
| Q |
199 |
catgtaaactttattgtactggtttgtttatgctcatagtggattcattgttgctctctgttcggtggagtatgtctttaaagctgaaccacataaaaaa |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43033700 |
catgtaaactttattgtactggtttgtttatgctcatagtggattcattgttgctctctgtccggtggagtatgtctttaaagctgaaccacataaaaaa |
43033601 |
T |
 |
| Q |
299 |
tttgtgttcatcttattctcttgtc |
323 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43033600 |
tttgtgttcatcttattctcttgtc |
43033576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University