View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_low_38 (Length: 220)
Name: NF21210_low_38
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 47075676 - 47075880
Alignment:
| Q |
1 |
accaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcatgacaaaaacccagcaatctaactaggttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075676 |
accaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcatgacaaaaacccagcaatctaactaggttc |
47075775 |
T |
 |
| Q |
101 |
ctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctctagtctcttcactgcaatcaatctcttac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47075776 |
ctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctctagtctcttcactgcaatcaatctcttac |
47075875 |
T |
 |
| Q |
201 |
ctttg |
205 |
Q |
| |
|
||||| |
|
|
| T |
47075876 |
ctttg |
47075880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 47068654 - 47068450
Alignment:
| Q |
1 |
accaaacagaagcttttcaagtgatccgttgctcatgtattcataaaccaaaagcctttttgaaccctcatgacaaaaacccagcaatctaactaggttc |
100 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
47068654 |
accaaaaagaagctttccaagtgatccgttgctcatgtattcataaaccagaagcctttttgaaccctcaacacaaaaaccaagcaatctaactaggttc |
47068555 |
T |
 |
| Q |
101 |
ctgtggtgggttttcccaatggatctcacttctgcttgaaattccctttccccatcttccaccaccttctctagtctcttcactgcaatcaatctcttac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
47068554 |
ctgtggtgggttttcccaatggatctcacttctgcttgaaattccttttcaccttcttccaccactttttctagtctcttcactgcaatcaatctcttac |
47068455 |
T |
 |
| Q |
201 |
ctttg |
205 |
Q |
| |
|
||||| |
|
|
| T |
47068454 |
ctttg |
47068450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University