View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21210_low_39 (Length: 217)
Name: NF21210_low_39
Description: NF21210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21210_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 3022846 - 3022658
Alignment:
| Q |
15 |
caaaggaaacatgtaaactatattttgcgtactttgttctagcccagagtgttgttta----cttattatctcgaaataattttagctaaaacttactca |
110 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3022846 |
caaaggaaacgtgtaaactatattttgcgtactttgttctagcccagagtgttgtttaattacttattatctcgaaataattttagctaaaacttactca |
3022747 |
T |
 |
| Q |
111 |
aattgctcttgattcttttggaccttgaatcacccatttcaagtgatgatatggaccatctttcctcaaaataagactcttgaactttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3022746 |
aattgctcttgattcttttggaccttgaatcacccatttcaagtgatgatatggaccatctttcctcaaaataagactcttgaactttt |
3022658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University