View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21211_low_1 (Length: 241)

Name: NF21211_low_1
Description: NF21211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21211_low_1
NF21211_low_1
[»] chr7 (1 HSPs)
chr7 (32-228)||(33599216-33599412)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 228
Target Start/End: Original strand, 33599216 - 33599412
Alignment:
32 tattgaacccgcaacactaaaaagatgacattgcccatgaatattcacataattaaacattaaaaatatatcaaaataatcaacaaataggaaaatactt 131  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33599216 tattgaacccacaacactaaaaagatgacattgcccatgaatattcacataattaaacattaaaaatatatcaaaataatcaacaaataggaaaatactt 33599315  T
132 gtgttcggatagcttgttcataaagggagttacatcagcctccaaagctgacatgtgtctaaatggatttttagccttgcaccaacaatatgtatca 228  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
33599316 gtgttcggatagcttgttcataaagggagttacatcagcctccaaagctgacatgtgtctaaatggatttttagccctgcaccaacaatatgtatca 33599412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University