View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21212_low_7 (Length: 262)
Name: NF21212_low_7
Description: NF21212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21212_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 31028865 - 31028617
Alignment:
| Q |
1 |
tgcatttaagtcatattatttttactgaggggccattatatttatatgtagccgaaaggcctacacgtttgcatattatatcattcgtgtctccatcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028865 |
tgcatttaagtcatattatttttaccgaggggacattatatttatatgtagccgaaaggcctacacgtttgcatattatatcattcgtgtctccatcttt |
31028766 |
T |
 |
| Q |
101 |
gatgctctgcaattatagctctgcggggcctgatcttatattcttttttaattggttgataatctagtcatat---actatatgttatactttgccaaga |
197 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31028765 |
gatgttctgcaattatagctctgcggggcctgatcttatattcttttttaatttgttgataatctagtcatatactactatatgttatactttgccaaga |
31028666 |
T |
 |
| Q |
198 |
caacataccattatgggataagaaaaatatgctcacgtagagtacaagc |
246 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31028665 |
caaaataccattatgggataagaaaaatatgctcacgtagagtacaagc |
31028617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University