View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_high_46 (Length: 288)
Name: NF21213_high_46
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_high_46 |
 |  |
|
| [»] scaffold0263 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 43240079 - 43239907
Alignment:
| Q |
16 |
atacctgcaatgagtagggtaaaactccgctttcatggatccggacttggatctaggaattacccgcaaatttaactaggcatgggtacggggtaagact |
115 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43240079 |
atacctgtaatgagtagggtaaaaccccgctttcatggatccggacttggatctaggaattacccgcaaatttaattaggcatgggtacggggtaagact |
43239980 |
T |
 |
| Q |
116 |
ttgtttgggagtttgga-gggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43239979 |
ttgtttgagagtttggaggggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
43239907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 187
Target Start/End: Original strand, 79466 - 79520
Alignment:
| Q |
133 |
gggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||| |||||| ||||| | || |||||||||||||||||||||||||||||| |
|
|
| T |
79466 |
gggaagggaaggctttgaggagtggaaaatatgagggaaaatggagaaatctttc |
79520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 187
Target Start/End: Complemental strand, 34336295 - 34336211
Alignment:
| Q |
109 |
taagactttgtttgggagtttggaggg------aatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||| ||||||||| |||||||||||| |||||||| ||||| || || ||||||||||| |||||||||||||||||| |
|
|
| T |
34336295 |
taaggctttgtttgtgagtttggaggggaggagaatggaagactttgaggggtggaaaatatgaggaaaaatggagaaatctttc |
34336211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 38552072 - 38552011
Alignment:
| Q |
29 |
gtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||| | | || ||||||||||||||||| |
|
|
| T |
38552072 |
gtagggtaaaaccccgctttcatgggtccgggcttgggtatgggtaattacccgcaaattta |
38552011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 187
Target Start/End: Original strand, 41865503 - 41865535
Alignment:
| Q |
155 |
tgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41865503 |
tgaaaaatatgagggaaaatgaagaaatctttc |
41865535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 183
Target Start/End: Complemental strand, 13044406 - 13044333
Alignment:
| Q |
111 |
agactttgtttgggagtttgga-gggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatc |
183 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| |||| || || || ||||||||||||| ||||||||||||||| |
|
|
| T |
13044406 |
agactttgtttgcgagtttggaagggaatgaaaggcttcgaggggtgaaaaatatgagagaaaatggagaaatc |
13044333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 25047428 - 25047389
Alignment:
| Q |
16 |
atacctgcaatgagtagggtaaaactccgctttcatggat |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25047428 |
atacctgcaatgggtagggtaaaactccgctttcatggat |
25047389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 109 - 187
Target Start/End: Original strand, 38505160 - 38505244
Alignment:
| Q |
109 |
taagactttgtttgggagtttggaggg------aatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||| |||||||||||||||||||||| || |||||| ||||| || || ||||| |||||||||||||||||||||||| |
|
|
| T |
38505160 |
taaggctttgtttgggagtttggaggggaggggaagggaaggctttgaggggtggaaaatttgagggaaaatggagaaatctttc |
38505244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 33979338 - 33979277
Alignment:
| Q |
29 |
gtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||| | | || ||||||||||||||||| |
|
|
| T |
33979338 |
gtagggtaaaaccacgctttcatggatccgggcttgggtatgggtaattacccgcaaattta |
33979277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 109 - 137
Target Start/End: Original strand, 32851670 - 32851698
Alignment:
| Q |
109 |
taagactttgtttgggagtttggagggaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32851670 |
taagactttgtttgggagtttggagggaa |
32851698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 30775314 - 30775253
Alignment:
| Q |
29 |
gtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| | | || ||||||||||||||||| |
|
|
| T |
30775314 |
gtagggtaaaactccgctttcatagatccggacttgggtatgggtaattacccgcaaattta |
30775253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 20 - 90
Target Start/End: Complemental strand, 16187282 - 16187211
Alignment:
| Q |
20 |
ctgcaatgagtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaatttaa |
90 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||| || |||| | | || |||||||||||||||||| |
|
|
| T |
16187282 |
ctgctatgggtagggtaaaactccgctttcatggatcagggtttgggtatgggtaattacccgcaaatttaa |
16187211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 14569904 - 14569950
Alignment:
| Q |
141 |
aaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||| ||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
14569904 |
aaggctttgaggggtggaaaatatgagggaaaatggagaaatctttc |
14569950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 35854025 - 35853964
Alignment:
| Q |
29 |
gtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| ||||| | | || ||||||||||||||||| |
|
|
| T |
35854025 |
gtagggtaaaaccccgttttcatggatccgggcttgggtatgggtaattacccgcaaattta |
35853964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 187
Target Start/End: Original strand, 10955557 - 10955589
Alignment:
| Q |
155 |
tgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
10955557 |
tgaaaaatatgaggaaaaatggagaaatctttc |
10955589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000007; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 32133982 - 32133914
Alignment:
| Q |
22 |
gcaatgagtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
|||||| |||||||||||| |||||||||||| ||||||||||| | | || ||||||||||||||||| |
|
|
| T |
32133982 |
gcaatgggtagggtaaaaccccgctttcatgggtccggacttgggtatgggtaattacccgcaaattta |
32133914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 111 - 187
Target Start/End: Original strand, 41817123 - 41817199
Alignment:
| Q |
111 |
agactttgtttgggagtttggagggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||||||| || || ||||||| ||| ||||| |||| ||||||| |
|
|
| T |
41817123 |
agactttgtttgggagtttggaggaaaggaaaggttttgaggggtgtaaaatataaggaaaaatagagagatctttc |
41817199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 16 - 55
Target Start/End: Complemental strand, 7815369 - 7815330
Alignment:
| Q |
16 |
atacctgcaatgagtagggtaaaactccgctttcatggat |
55 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
7815369 |
atacctgcaatgggtagggtaaaactccgcttttatggat |
7815330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 88
Target Start/End: Complemental strand, 48514938 - 48514879
Alignment:
| Q |
30 |
tagggtaaaactccgctttcatggatccggacttggatct-aggaattacccgcaaattt |
88 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| | || |||||||||||||||| |
|
|
| T |
48514938 |
tagggtaaaaccccgctttcatggatccgagcttggatatgagtaattacccgcaaattt |
48514879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 187
Target Start/End: Complemental strand, 69954 - 69912
Alignment:
| Q |
145 |
ttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||||||||| |
|
|
| T |
69954 |
ttttgaggggtgaaaaatatgagggaaaatgaagaaatctttc |
69912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 89
Target Start/End: Complemental strand, 39027241 - 39027167
Alignment:
| Q |
16 |
atacctgcaatgagtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
||||| || ||| |||||||||||| |||||||||||| ||||||||||| | | || |||||| |||||||||| |
|
|
| T |
39027241 |
atacccgctatgggtagggtaaaaccccgctttcatgggtccggacttgggtatgggtaattactcgcaaattta |
39027167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 146 - 187
Target Start/End: Complemental strand, 14439792 - 14439751
Alignment:
| Q |
146 |
tttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
14439792 |
tttgaggggtgaaaaatatgaggaaaaatggagaaatctttc |
14439751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 65
Target Start/End: Original strand, 28192093 - 28192129
Alignment:
| Q |
29 |
gtagggtaaaactccgctttcatggatccggacttgg |
65 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28192093 |
gtagggtaaaaccccgctttcatgggtccggacttgg |
28192129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 132 - 187
Target Start/End: Complemental strand, 47359550 - 47359495
Alignment:
| Q |
132 |
agggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||| |||||| ||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
47359550 |
agggaagggaaggctttgaggggtggaaaatatgagggaaaatggagaaatctttc |
47359495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 187
Target Start/End: Complemental strand, 27197482 - 27197428
Alignment:
| Q |
133 |
gggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||||| |||| |||||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
27197482 |
gggaatgaaaggctttgaagggtgaaaaatatgagagaaaatggaaaaatctttc |
27197428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 133 - 187
Target Start/End: Complemental strand, 34280722 - 34280668
Alignment:
| Q |
133 |
gggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||| |||||| ||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
34280722 |
gggaagggaaggctttgaggggtggaaaatatgagggaaaatggagaaatctttc |
34280668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 108 - 187
Target Start/End: Original strand, 517452 - 517532
Alignment:
| Q |
108 |
gtaagactttgtttgggagtttggaggg-aatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||| |||||||||| ||||||||||| || |||||| || | ||| || ||||||| ||||||||| |||||||||||| |
|
|
| T |
517452 |
gtaaggctttgtttggtagtttggaggggaagggaaggcttgggagggtggaaaatattagggaaaattgagaaatctttc |
517532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 33900560 - 33900615
Alignment:
| Q |
132 |
agggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||||||| ||||| ||||||| |||| |
|
|
| T |
33900560 |
agggaatgaaaggttttgaagggtgcaaaatatgaggaaaaatagagaaatttttc |
33900615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 38694437 - 38694507
Alignment:
| Q |
20 |
ctgcaatgagtagggtaaaactccgctttcatggatccggacttggatctagg-aattacccgcaaattta |
89 |
Q |
| |
|
|||| ||| ||||| ||||||||||||||||||| ||||| ||||| | | || ||||||||||||||||| |
|
|
| T |
38694437 |
ctgcgatgggtaggataaaactccgctttcatgggtccgggcttgggtatgggtaattacccgcaaattta |
38694507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 187
Target Start/End: Complemental strand, 49183895 - 49183866
Alignment:
| Q |
158 |
aaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49183895 |
aaaatatgagggaaaatggagaaatctttc |
49183866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 187
Target Start/End: Original strand, 50534978 - 50535007
Alignment:
| Q |
158 |
aaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50534978 |
aaaatatgagggaaaatggagaaatctttc |
50535007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 139 - 187
Target Start/End: Complemental strand, 3537435 - 3537387
Alignment:
| Q |
139 |
ggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||||| ||||| || || |||||||||||||||||| ||||||||||| |
|
|
| T |
3537435 |
ggaaggctttgaggggtggaaaatatgagggaaaatgaagaaatctttc |
3537387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 114 - 187
Target Start/End: Complemental strand, 34757856 - 34757787
Alignment:
| Q |
114 |
ctttgtttgggagtttggagggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| || || |||||||||| |||||| |||||||||||| |
|
|
| T |
34757856 |
ctttgtttgcgagtttggaggg----gaaggttttgaggggtggaaaatatgagagaaaattgagaaatctttc |
34757787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 139 - 186
Target Start/End: Original strand, 41099967 - 41100014
Alignment:
| Q |
139 |
ggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatcttt |
186 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||| |||||||||| |
|
|
| T |
41099967 |
ggaaggctttgaggggtgaaaaatatgagggaaaatgaagaaatcttt |
41100014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 109 - 187
Target Start/End: Original strand, 9104767 - 9104846
Alignment:
| Q |
109 |
taagactttgtttgggagtttggagggaatggaagg-ttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
|||| ||||||||||||||||||| || |||| ||| ||||| ||| ||| ||| || ||||||||||||||||||||| |
|
|
| T |
9104767 |
taaggctttgtttgggagtttggaagggatgggagggttttggaggatgagaaacatatgggaaaatggagaaatctttc |
9104846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 133 - 187
Target Start/End: Original strand, 24849395 - 24849449
Alignment:
| Q |
133 |
gggaatggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatctttc |
187 |
Q |
| |
|
||||||| |||||||||| || || ||||||||||||||||| ||||||||||| |
|
|
| T |
24849395 |
gggaatgaaaggttttgaggggtggaaaatatgagggaaaattaagaaatctttc |
24849449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0263 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0263
Description:
Target: scaffold0263; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 186
Target Start/End: Original strand, 5807 - 5884
Alignment:
| Q |
115 |
tttgtttgggagtttggagggaat------ggaaggttttgaaggttgaaaaatatgagggaaaatggagaaatcttt |
186 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| || || ||||||||||||||||||||||||||||| |
|
|
| T |
5807 |
tttgtttgggagtttggagggaagaggaagggaagactttgaggggtggaaaatatgagggaaaatggagaaatcttt |
5884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University