View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_high_58 (Length: 250)
Name: NF21213_high_58
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_high_58 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 33134919 - 33134683
Alignment:
| Q |
1 |
tgaaaccatggaaaaataattcaaaacatggtaagccaagaagtataaatgatgtctgggtatgaatggatggaaggtttgccctctaaaatcaataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
33134919 |
tgaaaccatggaaaaataattcaaaacatggtaagccaagaagtataa-tgatgtctgggtatgaatggattgaaggtttgcactctaaaatcaataatt |
33134821 |
T |
|
| Q |
101 |
gaatcctggcatttcaaactgggagccaaatgtctcaacccgatttctgaggtcaaaaatatctttattactctgaagacccttgagaaaatctttgcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33134820 |
gaatcctggcatttcaaactgggagccaaatgtctcaacccgatttctgaggtcaaaaatatctttattactctgaagacccttgagaaaatctttgcat |
33134721 |
T |
|
| Q |
201 |
gatttaccatgttccctctgtattatgcttgtaatctg |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33134720 |
gatttaccatgttccctctgtattatgcttgtaatctg |
33134683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University