View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_high_75 (Length: 235)
Name: NF21213_high_75
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_high_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 11797523 - 11797303
Alignment:
| Q |
1 |
actacgttaatgcaagagaatagcttcatttggaagaacaagcttcatgatatgcaagttttgcagcttgtttttacgatgggccgacaaattatggatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||| |
|
|
| T |
11797523 |
actacgttaatgcaagagaatagcttcatttggaagaacaagcttcatgatatgcaagttttgcagcttgtttttacaatgggccgacaaactatgaatt |
11797424 |
T |
|
| Q |
101 |
ttctgagtaattcttagactaaaatgtctcagaactgagaaaatcaatttcaattgttggttcaagaagatacaaaaagacgagcaagctaaatcaaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||| ||||||| ||| |
|
|
| T |
11797423 |
ttctgagtaattcttagactaaaatgtctcagaactgagaaaatcaatttcaattggtggttcaagaagatacaaaaaga-taataagttaaatcataag |
11797325 |
T |
|
| Q |
201 |
caaactgagactagcaaaggat |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
11797324 |
caaacggagactagcaaaggat |
11797303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University