View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_high_80 (Length: 227)
Name: NF21213_high_80
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_high_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 1832642 - 1832850
Alignment:
| Q |
1 |
gtaaatttgagggatttatttaatttgtattattcataaccaatcatagtttgtgattttatttctgggtagagagttgtggttcggttttcatttcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1832642 |
gtaaatttgagggatttatttaatttgtattattcataaccaatcatagtttgtgattttatttctgggtagagagttgtggttcggttttcatttcttc |
1832741 |
T |
 |
| Q |
101 |
atattctcttctcttgtgtgactcgactcacatgtggccttgttattatcgatgtcgttttcacctattttggagaatcctttcaaaccactttctttct |
200 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1832742 |
atattctctt-----gtgtgactcg-----catgtggccttgttattatcgatgtcgttttcacctattttggagaatcctttcaaactactttctttct |
1832831 |
T |
 |
| Q |
201 |
tgccctttactattatctt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1832832 |
tgccctttactattatctt |
1832850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University