View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_high_84 (Length: 206)
Name: NF21213_high_84
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_high_84 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 41066953 - 41066781
Alignment:
| Q |
20 |
ccatgtgatttctaagagtacgtaggcattttagtccttgaaattatggggattactcaatttagcctcaaatttatgaaatagcagcctagtcgcatta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066953 |
ccatgtgatttctaagagtacgtaggcattttagtccttgaaattatgaggattagtcaatttagcctcaaatttatgaaatagcagcctagtcgcatta |
41066854 |
T |
 |
| Q |
120 |
attgaacaatgtcggtcaatttaatcnnnnnnnccttcaaatttaacaccttcgttttaaaggttatattctt |
192 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066853 |
attgaacaatgtcggtcaatttaatctttttttccttcaaatttaacaccttcgttttaaaggttatattctt |
41066781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University