View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_22 (Length: 467)
Name: NF21213_low_22
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 2e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 376 - 452
Target Start/End: Complemental strand, 22659167 - 22659089
Alignment:
| Q |
376 |
agtgaatggatatg--caagagactagtggtgtgtgtaaattggtccaataataatgatgattaatttggctcatagtt |
452 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
22659167 |
agtggatggatatgtacaagagactagtggtgtgtgtaaattggtcctataataatgatgattaatttggctcatagtt |
22659089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 114 - 189
Target Start/End: Complemental strand, 22659283 - 22659208
Alignment:
| Q |
114 |
taagagtgcgagatcgaactcttgacaagttgttcaagagatgaaattcctttaccgcttggacgatatatttttt |
189 |
Q |
| |
|
||||||| |||||| |||| || |||| ||||||||||||| ||| ||||||| ||||| ||||||||||||||| |
|
|
| T |
22659283 |
taagagtcagagatcaaacttttaacaaattgttcaagagataaaactcctttatcgctttgacgatatatttttt |
22659208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University