View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_38 (Length: 336)
Name: NF21213_low_38
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 170 - 326
Target Start/End: Original strand, 39768373 - 39768529
Alignment:
| Q |
170 |
actgtctctttacatatatatttcttttaggctgaatttgctcaacatcaaaaacctcaaacattagacgtctcacatcacgtttcccataaacagcata |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39768373 |
actgtctctttacatatatatttcttttaggctgaatttgctcaacatcaaaaacctcaaacattagacgtctcacatcacgtttcccataaacagcata |
39768472 |
T |
 |
| Q |
270 |
cgaaagcccgtgaagggcttgttgaacagatactgtggccgggtttctcagtctgtg |
326 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39768473 |
cgaaagcccgtgaagggcttgttgaacagataccgtggccgggtttctcagtctgtg |
39768529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 39768233 - 39768293
Alignment:
| Q |
20 |
agtactaggtattttgcattctatattcacctacctgaccattaagttgataacctaaacc |
80 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39768233 |
agtacaaggtattttgcattctatattcacctacctgaccattaagttgataacctaaacc |
39768293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 195 - 323
Target Start/End: Complemental strand, 5689561 - 5689433
Alignment:
| Q |
195 |
tttaggctgaatttgctcaacatcaaaaacctcaaacattagacgtctcacatcacgtttcccataaacagcatacgaaagcccgtgaagggcttgttga |
294 |
Q |
| |
|
|||||||||||| ||||||| |||||| ||||||||| |||||||||||||| ||||||||||||||| |||||| || || |||| ||||| | | |
|
|
| T |
5689561 |
tttaggctgaatctgctcaaagtcaaaatactcaaacatcagacgtctcacatcgcgtttcccataaacaagatacgagagtccatgaatagcttgatta |
5689462 |
T |
 |
| Q |
295 |
acagatactgtggccgggtttctcagtct |
323 |
Q |
| |
|
|||| | |||||| ||||||||| |||| |
|
|
| T |
5689461 |
acagctgttgtggctgggtttctccgtct |
5689433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University