View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_51 (Length: 273)
Name: NF21213_low_51
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_51 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 64 - 249
Target Start/End: Original strand, 8191810 - 8191995
Alignment:
| Q |
64 |
gttaatgtgttatatcctctgtagaactgaaacttcattggagacgtgtcttgtgtccgaaattgacacattgtgatcacattcaattatttcacctttt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8191810 |
gttaatgtgttatatcctctgtagaactgaaacttcattggagacgtgtcttgtgtccgaaattgacacattgtgatcacattcaattatttcacctttt |
8191909 |
T |
 |
| Q |
164 |
caaattatcaccgttattgtgtcttgtgtttgtgttagtgcttcataggttatattcattttcttaattcttgtattggcacagcc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8191910 |
caaattatcaccgttattgtgtcttgtgtttgtgttagtgcttcataggttatattcattttcttaattcttgtattggcacagcc |
8191995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University