View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_62 (Length: 250)
Name: NF21213_low_62
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 27884695 - 27884933
Alignment:
| Q |
1 |
gcgtagcggccagcggcagtggaggctgtgtgggtcccatgaccgtcggcgtcacgaggggatcgaaactcaactgtttcgttgattgggttcaaaggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27884695 |
gcgtagcggccagcggcagtggaggctgtgtgggtcccatgaccgtcggcgtcacgaggggatcgaaactcaactgtttcgttgattgggttcaaaggcc |
27884794 |
T |
|
| Q |
101 |
cagcagaaccagcaccaacttcatgacctttggaaaagtatctagcaccgatgagttttctgttacagtttctgggtgagaatttttcaccagattcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27884795 |
cagcagaaccagcaccaacttcatgacctttggaaaagtatctagcaccgatgagttttctgttacagtttctgggtgagaatttttcaccagattcaca |
27884894 |
T |
|
| Q |
201 |
aactcctttccaacgacgtggaataggacccaaattcat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27884895 |
aactcctttccaacgacgtggaataggacccaaattcat |
27884933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University