View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_63 (Length: 249)
Name: NF21213_low_63
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_63 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 249
Target Start/End: Complemental strand, 25209808 - 25209567
Alignment:
| Q |
10 |
ataatactatgcttcataaggaattacaannnnnnnnncttgctacttttgttattgtattttaaatttatatgccgtacctggccagttattacctaga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25209808 |
ataatactatgcttcataaggaattacaatttttttttcttgctacttttgttattgtattttaaatttatatgccgtacctggccagttattacctaga |
25209709 |
T |
 |
| Q |
110 |
taacaatgaaaataaactaataacaaagtaacaaggtcacatgtgatataat--tatataatatgtaatataatcttttaaaaaacatggactctggatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25209708 |
taacaatgaaaataaactaataacaaagtaacaaggtcacatgtgatatgattatatataatatgtaatataatcttttaaaaaacatggactctggatt |
25209609 |
T |
 |
| Q |
208 |
cttgtgatgaaagttctacaagagcatcttctaaatattttt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25209608 |
cttgtgatgaaagttctacaagagcatcttctaaatattttt |
25209567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University