View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_72 (Length: 237)
Name: NF21213_low_72
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_72 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 60 - 222
Target Start/End: Complemental strand, 25209503 - 25209337
Alignment:
| Q |
60 |
gatgggttagatgaagtttaggtttgtgtgacatacatcatat------gtgtctatatatattgaagtatagtttgcaacactttgtgatcttagaaag |
153 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25209503 |
gatgggttagatgaaatataggtttgtgtgacatatatcatattcatatgtgtctatatatattgaagtatagtttacaacactttgtgatcttagaaag |
25209404 |
T |
|
| Q |
154 |
cttgatgaacaaaaatttcttagtaacttagatcattgtcaatatataatcatcattgtgctttttctt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25209403 |
cttgatgaacaaaaatttcttagtaacttagatcattgtcaa--tataatcatcattgtgctttttctt |
25209337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University