View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21213_low_73 (Length: 236)
Name: NF21213_low_73
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21213_low_73 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 7657763 - 7657582
Alignment:
| Q |
23 |
acattcttatttccatttttaccctctggcattccacctccatttttgccaccattgttcttattacctccaccttgattctgactctgattatttccac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7657763 |
acattcttatttccatttttaccctctggcattccacctccatttttgccaccattgttcttattacctccaccttgattctgactctgattatttccgc |
7657664 |
T |
 |
| Q |
123 |
cgccacccccaccacctttctttccaccacccaagccatgaacttgaacaggcacaggtcctcctcctccacctttctttccatt |
207 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
7657663 |
caccaccaccaccacctttctttccaccacccaagccatgaacttgaacaggcacagg---tcctgctccacctttctttccatt |
7657582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 91 - 147
Target Start/End: Complemental strand, 7652318 - 7652262
Alignment:
| Q |
91 |
tccaccttgattctgactctgattatttccaccgccacccccaccacctttctttcc |
147 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | || ||||||||||||||||| |
|
|
| T |
7652318 |
tccaccttgattctgaatctgattatttccaccttcgccaccaccacctttctttcc |
7652262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 23 - 61
Target Start/End: Complemental strand, 7652350 - 7652312
Alignment:
| Q |
23 |
acattcttatttccatttttaccctctggcattccacct |
61 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7652350 |
acattcttatttccatttttaccttctggcattccacct |
7652312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University