View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21213_low_75 (Length: 236)

Name: NF21213_low_75
Description: NF21213
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21213_low_75
NF21213_low_75
[»] chr4 (1 HSPs)
chr4 (1-221)||(27884334-27884554)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 27884554 - 27884334
Alignment:
1 tcaacgacggcgttgatgtaatttccatttcaatcggcggcggagatggtatagcttcaccttactatctcgacccgattgcaatcggatcttacggtgc 100  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27884554 tcaacgacggcgttgatgtaatttctatttcaatcggcggcggagatggtatagcttcaccttactatctcgacccgattgcaatcggatcttacggtgc 27884455  T
101 tgtttcaagaggagttttcgtttcatcctccgccggaaacgatggaccaagtggaatgtcagtaaccaaccttgctccgtggttaacaaccgtaggagca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||    
27884454 tgtttcaagaggagttttcgtttcatcctccgccggaaacgatggaccaagtggaatgtcagtaaccaacctcgctccatggttaacaaccgtaggagca 27884355  T
201 ggcactatagatcgtgatttt 221  Q
    |||||||||||||||||||||    
27884354 ggcactatagatcgtgatttt 27884334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University