View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21214_high_10 (Length: 242)
Name: NF21214_high_10
Description: NF21214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21214_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 38094396 - 38094650
Alignment:
| Q |
1 |
tagcctaaaattttgaagtctaacaccctagcatggg-------------tggcaacaatctttggagattcgatggttgtgcccgaaactctccgacgc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38094396 |
tagcctaaaattttgaagtctaacaccctagcatgggacaaccatgatggtggtaacaatctttggagattcgatggttgtgcccgaaactctccgacgc |
38094495 |
T |
 |
| Q |
88 |
ccaagttaacgagagttgagaaagagttgaatgtaaatgaa------gtgtttaacaaccttgatgaatgattatctctatttattataggtttgacaat |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38094496 |
ccaagttaacgagagttgagaaagagttgaatgtaaatgaacttgaagtgtttaacaaccttgatgaatgattatctctatttattataggtttgacaat |
38094595 |
T |
 |
| Q |
182 |
aatgtcctaggtttaagtggacacgtgagtgagttccatatgagagtataatcta |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
38094596 |
aatgtcctaggtttaagtggacacgtgagtgagttccatacgagagtatactcta |
38094650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University