View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21214_high_4 (Length: 302)
Name: NF21214_high_4
Description: NF21214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21214_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 7 - 286
Target Start/End: Complemental strand, 52546009 - 52545730
Alignment:
| Q |
7 |
cttttgatactcatgagttaatttgcactcatctttcatatttactctgcttcctaactcttgtggcaacgattaacatggattaatggataaataattt |
106 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52546009 |
cttttgatactcgtgagttaatttgcactcatctttcatatttactctgcttcctaactcttgtggtaacgattaacatggattaatggataaataattt |
52545910 |
T |
 |
| Q |
107 |
ggctctaaatgatttagtattttctttttatgttttggcaggactgcattggcaagcaatcttgcatggtaactgtaactcctgaaaattttggtggaga |
206 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52545909 |
ggctctaaacgatttagtattttctttttatgttttggcaggactgcattggcaagcaatcttgcatggtaactgtaactcctgaaaattttggtggaga |
52545810 |
T |
 |
| Q |
207 |
cccttgtccaggaattgcaaagaagttctcagttgaagccctatgcagctaggatcacgtcgtacaacaatttttcaaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52545809 |
cccttgtccaggaattgcaaagaagttctcagttgaagccctatgcagctaggaacacgtcgtacaacaatttttcaaat |
52545730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University