View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21214_low_12 (Length: 241)
Name: NF21214_low_12
Description: NF21214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21214_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 21369137 - 21368913
Alignment:
| Q |
1 |
ttttagctgtgtatttcaacacaaatcgtcgtaattaactacatatttgacctgcatcaaccatccaaactgttgttgaaatttgtgt--caaaatatcg |
98 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21369137 |
ttttaggtgtatatttcaacacaaatcgtcgtaattaactacatagttgacctgcatca----tccaaactgttgttgaaatttgtgtgtcaaaatatcg |
21369042 |
T |
|
| Q |
99 |
tttctgattaattaaaacatcaacacggtagcacaaaatttgaaaatggagctcta-caccaacggaacaatgaatctaacagatcaattgggaaaatgg |
197 |
Q |
| |
|
|||||||||||||||||||| ||||| | |||||||||||||||||||||| ||| ||||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
21369041 |
tttctgattaattaaaacatgaacacaatggcacaaaatttgaaaatggagccctaccaccagcagaacaatgaatctagcagatcaattgggaaaatgg |
21368942 |
T |
|
| Q |
198 |
cagggagctacttctcaatacacagatat |
226 |
Q |
| |
|
||||| ||||||||| |||||| |||||| |
|
|
| T |
21368941 |
cagggggctacttctgaatacatagatat |
21368913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 86
Target Start/End: Complemental strand, 37494788 - 37494732
Alignment:
| Q |
30 |
cgtaattaactacatatttgacctgcatcaaccatccaaactgttgttgaaatttgt |
86 |
Q |
| |
|
||||||||| |||||||||| |||||| ||||||||||| |||| | ||||||||| |
|
|
| T |
37494788 |
cgtaattaatcacatatttgaactgcattaaccatccaaattgttatcgaaatttgt |
37494732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University