View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21214_low_14 (Length: 239)
Name: NF21214_low_14
Description: NF21214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21214_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 34488932 - 34488724
Alignment:
| Q |
19 |
gttatggctttgttgaccctagatcagtgtgttcctatacaatcttc-ataactacacgaattcactcattcatatgccttttgatgccttgtgatgtta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34488932 |
gttatggctttgttgaccctagatcagtgtgttcctatacaatcttccataactacacgaattcactcattcatatgccttttgatgccttgtgatgtta |
34488833 |
T |
|
| Q |
118 |
ctgacaattgtaattcaagtttggaacaccacatggccactatcacttaacaattttgaccacctcgcacttcagtttagaagaccaacaccatttttgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34488832 |
ctgacaattgtaattcaagtttggaacaccacatggccactatcacttaacaattttgaccacctcgctcttcagtttagaagaccaacaccatttttgt |
34488733 |
T |
|
| Q |
218 |
atgctattc |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
34488732 |
atgctattc |
34488724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University