View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_high_29 (Length: 281)
Name: NF21215_high_29
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 256
Target Start/End: Original strand, 38404054 - 38404290
Alignment:
| Q |
20 |
tctacgacctatctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38404054 |
tctacgacctatctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacc |
38404153 |
T |
|
| Q |
120 |
tccacctcaaatctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgtt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38404154 |
tccacctcaaatctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatctgtcacgttctttattgggtttgtt |
38404253 |
T |
|
| Q |
220 |
ttgatgccatgggttattggattgattatggttctct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38404254 |
ttgatgccatgggttattggattgattatggttctct |
38404290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 31 - 226
Target Start/End: Complemental strand, 33530140 - 33529945
Alignment:
| Q |
31 |
tctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa |
130 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33530140 |
tctgcaatcgttctcaacctcccccgttcaccaccaatgccgttgaatatttccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa |
33530041 |
T |
|
| Q |
131 |
tctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgttttgatgc |
226 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
33530040 |
tctcacctgcgggttttgcctcctttcttctaggaatttcgatggctttgatgttttgcggatcagtcacgttctttattgggtttgttttgatgc |
33529945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 31 - 226
Target Start/End: Original strand, 16871207 - 16871402
Alignment:
| Q |
31 |
tctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa |
130 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16871207 |
tctgcaatcgttctcaacctcccccgttcaccaccaatgccgttgaatatttccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa |
16871306 |
T |
|
| Q |
131 |
tctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgttttgatgc |
226 |
Q |
| |
|
||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
16871307 |
tctcacctgcgggttttgcctcctttcttctaggaatttcgatggctttgatgttttgcggatcagtcacgttctttattgggtttgttttgatgc |
16871402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 251
Target Start/End: Complemental strand, 34808843 - 34808750
Alignment:
| Q |
158 |
ttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgttttgatgccatgggttattggattgattatggt |
251 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||||| || ||| | ||||| ||| | |||||||| ||||||||||||||| ||||||| |
|
|
| T |
34808843 |
ttctggggatttcggtggctttgatgctgtgtggatcggttactttcgtgattgggtttatgttgatgccgtgggttattggattggttatggt |
34808750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University