View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21215_high_29 (Length: 281)

Name: NF21215_high_29
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21215_high_29
NF21215_high_29
[»] chr3 (1 HSPs)
chr3 (20-256)||(38404054-38404290)
[»] chr5 (1 HSPs)
chr5 (31-226)||(33529945-33530140)
[»] chr2 (1 HSPs)
chr2 (31-226)||(16871207-16871402)
[»] chr8 (1 HSPs)
chr8 (158-251)||(34808750-34808843)


Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 256
Target Start/End: Original strand, 38404054 - 38404290
Alignment:
20 tctacgacctatctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacc 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38404054 tctacgacctatctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacc 38404153  T
120 tccacctcaaatctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgtt 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||    
38404154 tccacctcaaatctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatctgtcacgttctttattgggtttgtt 38404253  T
220 ttgatgccatgggttattggattgattatggttctct 256  Q
    |||||||||||||||||||||||||||||||||||||    
38404254 ttgatgccatgggttattggattgattatggttctct 38404290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 31 - 226
Target Start/End: Complemental strand, 33530140 - 33529945
Alignment:
31 tctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa 130  Q
    ||||||||| |||||||||||| ||| |||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
33530140 tctgcaatcgttctcaacctcccccgttcaccaccaatgccgttgaatatttccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa 33530041  T
131 tctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgttttgatgc 226  Q
    ||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| | || ||||| ||||||||||||||||| |||||||||||||    
33530040 tctcacctgcgggttttgcctcctttcttctaggaatttcgatggctttgatgttttgcggatcagtcacgttctttattgggtttgttttgatgc 33529945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 31 - 226
Target Start/End: Original strand, 16871207 - 16871402
Alignment:
31 tctgcaatccttctcaacctcctccgctcaccaccaacgccgttgaatttctccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa 130  Q
    ||||||||| |||||||||||| ||| |||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||    
16871207 tctgcaatcgttctcaacctcccccgttcaccaccaatgccgttgaatatttccaatcatccaccggagcaaccgttacggcgtttacctccacctcaaa 16871306  T
131 tctcacccgcgggttttgcctcccttcttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgttttgatgc 226  Q
    ||||||| ||||||||||||||| ||||||| ||||||||||||||||||||| | || ||||| ||||||||||||||||| |||||||||||||    
16871307 tctcacctgcgggttttgcctcctttcttctaggaatttcgatggctttgatgttttgcggatcagtcacgttctttattgggtttgttttgatgc 16871402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 158 - 251
Target Start/End: Complemental strand, 34808843 - 34808750
Alignment:
158 ttctgggaatttcgatggctttgatgctctgtggatcggtcacgttctttattggctttgttttgatgccatgggttattggattgattatggt 251  Q
    ||||||| |||||| ||||||||||||| ||||||||||| || ||| | ||||| ||| | |||||||| ||||||||||||||| |||||||    
34808843 ttctggggatttcggtggctttgatgctgtgtggatcggttactttcgtgattgggtttatgttgatgccgtgggttattggattggttatggt 34808750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University