View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_high_33 (Length: 250)
Name: NF21215_high_33
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_high_33 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 124 - 250
Target Start/End: Original strand, 7623691 - 7623817
Alignment:
| Q |
124 |
tttattctcttatataaaattcgaatgagtattaattttcaggttacaaaatgatgtgactctcgtataaatgacattgatagtgcaacttatgttgaaa |
223 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7623691 |
tttattctcttagataaaattcaaatgagtattaattttcaggttacaaaatgatgtgactctcgtataaatgacattgatagtgcaacttatgttgaaa |
7623790 |
T |
|
| Q |
224 |
ttgagaaaatgatattaattaactaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7623791 |
ttgagaaaatgatattaattaactaac |
7623817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Original strand, 7623405 - 7623530
Alignment:
| Q |
1 |
aatataaccaaaacttgttcatgactaaaaacacatactagctccttgaagatgcaaaacagcagtttgtattttcagaaaaatgtgaatactatatttt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7623405 |
aatataagcaaaacttgttcatgactaaaaacacatactagctccttgaagatgcaaaacagcagtttgtattttcagaaaaatgtgaatactatatttt |
7623504 |
T |
|
| Q |
101 |
taatttaattttctgggaagattttt |
126 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
7623505 |
taatttaattttctcggaagattttt |
7623530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 214 - 250
Target Start/End: Complemental strand, 7659908 - 7659872
Alignment:
| Q |
214 |
tatgttgaaattgagaaaatgatattaattaactaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7659908 |
tatgttgaaattgagaaaatgatattaattaactaac |
7659872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University