View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_high_34 (Length: 250)
Name: NF21215_high_34
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_high_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 37 - 166
Target Start/End: Original strand, 35261072 - 35261204
Alignment:
| Q |
37 |
ggacctaagaatgcatgggttagaaatgtgacctacactaggagactgacaa---agagtctctttgagaggagattttggaagggtaggattttagatg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
35261072 |
ggacctaagaatgcatgggttagaaatgtgacctacactaggagactgacaactaagagtctctttgagaggagatttttgaaggggaggattttagatg |
35261171 |
T |
|
| Q |
134 |
gccaagtctttactttgatttacatatgatatt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35261172 |
gccaagtctttactttgatttacatatgatatt |
35261204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University