View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_high_35 (Length: 250)
Name: NF21215_high_35
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_high_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 41 - 122
Target Start/End: Original strand, 34407478 - 34407559
Alignment:
| Q |
41 |
ttcattctctctattttcctaaaatcaattccaggagaagctccttctctctattttcctttagctgtctcgttttttctat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34407478 |
ttcattctctctattttcctaaaatcaattccaggagaagctccttctctctattttcctttagttgtctcgttttttctat |
34407559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 34399989 - 34400032
Alignment:
| Q |
1 |
ctcctatccagtttcaccttataccaaattgtgtgtgtacttca |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34399989 |
ctcctatccagtttcaccttataccaaattgtgtgtgtacttca |
34400032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 59 - 143
Target Start/End: Original strand, 34401434 - 34401520
Alignment:
| Q |
59 |
ctaaaatcaattccaggagaagctccttctctctattttcctttag--ctgtctcgttttttctattcctctcgcacaactcatttc |
143 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||||||||||||| |||||||||||||||| ||| || ||||| |||||||| |
|
|
| T |
34401434 |
ctaaaatcaattccatgagaaactcattctctctattttcctttagatctgtctcgttttttctcttcttcctgcacagctcatttc |
34401520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 34405671 - 34405714
Alignment:
| Q |
1 |
ctcctatccagtttcaccttataccaaattgtgtgtgtacttca |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34405671 |
ctcctatccagtttcaccttataccaaattgtgtgtgtacttca |
34405714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University