View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_high_43 (Length: 225)
Name: NF21215_high_43
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_high_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 12851011 - 12851200
Alignment:
| Q |
22 |
gggcagagaggtccttgttaaatctgttgctcaggcgatccctacatgttgcatgagcacagttttaataccatcgtcgttgggagaggaaatgggaaga |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
12851011 |
gggcagagaggtccttgttaaatctgttgctcatgcgatccctacatgttgcatgagcacaattttaataccattgtcgttgggagagaaaatggaaaga |
12851110 |
T |
 |
| Q |
122 |
atgattaattcatttttgtgggggtgaatagaggcactggtagaggaattaattggctaagttgagaaaaatttaccatgaggaaagaac |
211 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12851111 |
atgattaattcattttggtggaggtgaatagaggcacttgtagaggaattaattggctaagttgagaaaaacttaccatgaggaaagaac |
12851200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University