View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_low_16 (Length: 360)
Name: NF21215_low_16
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 238
Target Start/End: Complemental strand, 32237576 - 32237351
Alignment:
| Q |
13 |
aatatgcagaaagatggtatgannnnnnncctttaataaattagtatgcaggttcatcaatttcatttgtgatatgatgcattatcctatttttaacatt |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32237576 |
aatatgcagaaagatggtatgatttttttcctttaataaactagtatgcaggttcatcaacttcatttgtgatatgatgcattatcctatttttaacatt |
32237477 |
T |
|
| Q |
113 |
ttcgaaattataaattatgcacctcttctttataattttatgaatttaatgttgatgtactatcgctagattagttgaacaagtctactttataattgca |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32237476 |
ttcaaaattataaattatgcacctcttctttataattttatgaatttaatgttgatgtactatcgctagattagttgaacaagtctactttataattgca |
32237377 |
T |
|
| Q |
213 |
tttaaaaataactgaaacatatcttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32237376 |
tttaaaaataactgaaacatatcttc |
32237351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 280 - 344
Target Start/End: Complemental strand, 32237308 - 32237244
Alignment:
| Q |
280 |
ctaacaattacttaaatttgtgtgcagccaaatccatgtgatggtatttgcaacaggttcatatt |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32237308 |
ctaacaattacttaaatttgtgtgcagccaaatccatgtgatggtatttgcaacaggttcatatt |
32237244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University