View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_low_18 (Length: 352)
Name: NF21215_low_18
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 20 - 171
Target Start/End: Complemental strand, 19797091 - 19796945
Alignment:
| Q |
20 |
aaactgagatatttgtatttgcattttccatagtcatctacaagtcaaattataaaatggtgagaagggatggttgtgatgatctttacaactccattca |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
19797091 |
aaactgagatatttgtatttgcattttccatagtcatctacaagtcaaattataaaatggtgagaagggatggttgtgatgatttttgcaactccattca |
19796992 |
T |
|
| Q |
120 |
aattgaaatttaatttgttgaaaagaggattccaaaaatttgagacctagtt |
171 |
Q |
| |
|
| ||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19796991 |
atttgaaatttc-----ttgaaaagaggattcaaaaaatttgagacctagtt |
19796945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 270 - 326
Target Start/End: Complemental strand, 19796903 - 19796847
Alignment:
| Q |
270 |
catagggtttagattttgaaggttacctgttgaatagcgttaaggggtttcccagaa |
326 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||| |||||| |||| |
|
|
| T |
19796903 |
catagggtttagattttgaaggttacctgctgaattgcgttaaggagtttccaagaa |
19796847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University