View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_low_31 (Length: 261)
Name: NF21215_low_31
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 129 - 243
Target Start/End: Complemental strand, 40758262 - 40758148
Alignment:
| Q |
129 |
ggcagtggtttgatcatttatctcatgtctgatgtctctctgattcatattgtattcatgatggtggctgatcattcatatagcagtgtgcctacaagaa |
228 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40758262 |
ggcagtggtttgatcattcatctcatgtctgatgtctctatgattcatattatattcatgatggtggctgatcattcatattgcagtgtgcctacaagaa |
40758163 |
T |
 |
| Q |
229 |
gagacaacgtgatag |
243 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40758162 |
gagacaacgtgatag |
40758148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 77
Target Start/End: Complemental strand, 40758381 - 40758314
Alignment:
| Q |
10 |
attattctttcggtataaataacatcagcataacagttctttcaacatcaataatatcacaatgctta |
77 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40758381 |
attattctttcagtataaataacatcagcataacaattctttcaacatcaataatatcacaatgctta |
40758314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University