View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_low_36 (Length: 250)
Name: NF21215_low_36
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 3 - 169
Target Start/End: Original strand, 11338110 - 11338261
Alignment:
| Q |
3 |
gcaaattgatgattactgtctcaatgtacataatcaaacaaattgtaacatccatcatcagtcttcaaaaggcttcttccactccacattcaagtaactc |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11338110 |
gcaaattgatgattactgtctcattgtacataatcaaacaaattgtaacatccatcatcagtcttcagaaggcttcttccactccacattcaagtaactc |
11338209 |
T |
|
| Q |
103 |
tctaatttcatttagtccaatttcacttcgagacctataattcaaaaatatccataagactagaagt |
169 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11338210 |
tct---------------aatttcacttcgagacctataattcaaaaatatccataagactagaagt |
11338261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 133 - 169
Target Start/End: Complemental strand, 24022827 - 24022791
Alignment:
| Q |
133 |
agacctataattcaaaaatatccataagactagaagt |
169 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||| |
|
|
| T |
24022827 |
agacctataattcaaaaatatccattagtctagaagt |
24022791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University