View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_low_38 (Length: 248)
Name: NF21215_low_38
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 32945258 - 32945092
Alignment:
| Q |
19 |
cttgctgtgtactttaatcttattactcctgcgtgttacttcttattgttgttgtcgtattatttatgaattcgtagctgttaaattgagttttaattgt |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32945258 |
cttgttgtgtactttaatcttattactcctgcgtgttacttcttattgttgttgtcgtattgtttatgaattcgtagctgttaaattgagttttaattgt |
32945159 |
T |
|
| Q |
119 |
tggaaaatcataactgtgtcgtgcgaatccaaatcaattacttgatgttgccttgccgcccggtttc |
185 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
32945158 |
tggaaaatcataaatgtgtcgtgcgaatccaaatcaattacttgatgttgccttgcctccctgtttc |
32945092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 181 - 248
Target Start/End: Complemental strand, 32945030 - 32944963
Alignment:
| Q |
181 |
gtttctttcacgttgttgttccattcaattcatattgccgtgctagctccttgttgccatgtctattt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
32945030 |
gtttctttcacgttgttgttccattcaattcatattgccgtgctcgctcctggttgccatgtctattt |
32944963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University