View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21215_low_43 (Length: 225)

Name: NF21215_low_43
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21215_low_43
NF21215_low_43
[»] chr7 (1 HSPs)
chr7 (22-211)||(12851011-12851200)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 12851011 - 12851200
Alignment:
22 gggcagagaggtccttgttaaatctgttgctcaggcgatccctacatgttgcatgagcacagttttaataccatcgtcgttgggagaggaaatgggaaga 121  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||| ||||    
12851011 gggcagagaggtccttgttaaatctgttgctcatgcgatccctacatgttgcatgagcacaattttaataccattgtcgttgggagagaaaatggaaaga 12851110  T
122 atgattaattcatttttgtgggggtgaatagaggcactggtagaggaattaattggctaagttgagaaaaatttaccatgaggaaagaac 211  Q
    |||||||||||||||| |||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||    
12851111 atgattaattcattttggtggaggtgaatagaggcacttgtagaggaattaattggctaagttgagaaaaacttaccatgaggaaagaac 12851200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University