View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21215_low_44 (Length: 211)
Name: NF21215_low_44
Description: NF21215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21215_low_44 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 18 - 124
Target Start/End: Complemental strand, 35261500 - 35261394
Alignment:
| Q |
18 |
gaatttgacaaaaggactattatttatcaaatgaaatatattaaactgcaaaaagactaacttagaagtccttttctgcttattctctcaaacaattgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35261500 |
gaatttgacaaaaggactattatttatcaaatcaaatatattaaactgcaaaaagactaacttagaagtccttttctgcttattctttcaaacaattgtt |
35261401 |
T |
|
| Q |
118 |
ttaacag |
124 |
Q |
| |
|
||||||| |
|
|
| T |
35261400 |
ttaacag |
35261394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 35261376 - 35261340
Alignment:
| Q |
142 |
gaacacaatgtaattagaccgattatgaaacaaattt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35261376 |
gaacacaatgtaattagaccgattatgaaactaattt |
35261340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University