View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21216_high_5 (Length: 249)
Name: NF21216_high_5
Description: NF21216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21216_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 249
Target Start/End: Original strand, 29334791 - 29335022
Alignment:
| Q |
16 |
atggtggaagttgtgtagagtaattacaaacatgattnnnnnnnnnnnngtagacatacatagatgctctaaatttgtcttcctagagctcttatagaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29334791 |
atggtggaagttgtgtagagtaattacaaacatgatttatatatata--gtagacatacatagatgctctaaatttgtcttcctagagctcttatagaac |
29334888 |
T |
 |
| Q |
116 |
aagaaaaatagagtgaaatatcaaagcatagatttgtaataatagcattaaccctttcaaagtttcaatgttaattcaggtgctgaattctcaatgtcaa |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29334889 |
aagaaaaatagagtaaaatatcaaagcatagatttgtaataatagcattaaccctttcaaagtttcaatgttaattcaggtgctgaattctcaatgtcaa |
29334988 |
T |
 |
| Q |
216 |
ccaatggtttcacattcacctcactaaaacacat |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29334989 |
ccaatggtttcacattcacctcactaaaacacat |
29335022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University