View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21216_low_1 (Length: 405)
Name: NF21216_low_1
Description: NF21216
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21216_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 130 - 389
Target Start/End: Original strand, 43232045 - 43232316
Alignment:
| Q |
130 |
atataagacctctacttgatatttgttacacacagaaagctaaattgggattctcttggaagatgatttagaattcaaaatttcaaatctattgtgtgtg |
229 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43232045 |
atatgagacctctacttgatatttgttacacacagaaagctaaattgggattctcttggaagatgatgcagaattcaaaatttcaaatctattgtgtgtg |
43232144 |
T |
 |
| Q |
230 |
tgtaaatgccttcatgatcccttattacatacttatttaggttgacttgatttttaatccacttcaactcgatttgtct------------tctctctta |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
43232145 |
tgtaaatgccttcatgatcccttattacatacttatttacgttgacttgatttttaatccacttcaactcgttttgtcttctctaaaaccctctctctta |
43232244 |
T |
 |
| Q |
318 |
tctaaccctctccatctttattttccttctttactacaacttcttcagaggtaaggtttgtttcatttattt |
389 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43232245 |
tctaaccccctccatctttattttccttctttactacaacttcttcagaggtaaggtttgtttcatttattt |
43232316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 85 - 134
Target Start/End: Original strand, 43231969 - 43232018
Alignment:
| Q |
85 |
ccaaaaccataatatcatattatgtttacgggtcatcttacttgtatata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43231969 |
ccaaaaccataatatcatattatgtttatgggtcatcttacttgtatata |
43232018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University