View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21217_high_15 (Length: 275)
Name: NF21217_high_15
Description: NF21217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21217_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 49 - 171
Target Start/End: Original strand, 17296728 - 17296841
Alignment:
| Q |
49 |
ctcaatatcttcccacatcttaacagccctgcaccttttaacttatctcttaaattcaagttcattatagtagcatatgcttctcatgaacattttaatt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17296728 |
ctcaatatcttcccacatcttaacagccctgcacctttcaacttatctct---------gttcattatagtagcatatgcttctcatgaacattttaatt |
17296818 |
T |
 |
| Q |
149 |
ctgataaatttactaatttcttt |
171 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17296819 |
ctgataaatttactaatttcttt |
17296841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 203 - 260
Target Start/End: Original strand, 17297054 - 17297111
Alignment:
| Q |
203 |
atagtttaagatcacaataatgcatacagaatgtgaaaacacttagatgggttcaaat |
260 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17297054 |
atagtttaagatcacaataatgcatacataatgtgaaaacccttagatgggttcaaat |
17297111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University