View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21217_low_17 (Length: 275)

Name: NF21217_low_17
Description: NF21217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21217_low_17
NF21217_low_17
[»] chr7 (2 HSPs)
chr7 (49-171)||(17296728-17296841)
chr7 (203-260)||(17297054-17297111)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 49 - 171
Target Start/End: Original strand, 17296728 - 17296841
Alignment:
49 ctcaatatcttcccacatcttaacagccctgcaccttttaacttatctcttaaattcaagttcattatagtagcatatgcttctcatgaacattttaatt 148  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||         |||||||||||||||||||||||||||||||||||||||||    
17296728 ctcaatatcttcccacatcttaacagccctgcacctttcaacttatctct---------gttcattatagtagcatatgcttctcatgaacattttaatt 17296818  T
149 ctgataaatttactaatttcttt 171  Q
    |||||||||||||||||||||||    
17296819 ctgataaatttactaatttcttt 17296841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 203 - 260
Target Start/End: Original strand, 17297054 - 17297111
Alignment:
203 atagtttaagatcacaataatgcatacagaatgtgaaaacacttagatgggttcaaat 260  Q
    |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||    
17297054 atagtttaagatcacaataatgcatacataatgtgaaaacccttagatgggttcaaat 17297111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University