View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21217_low_18 (Length: 272)
Name: NF21217_low_18
Description: NF21217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21217_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 255
Target Start/End: Original strand, 3826160 - 3826403
Alignment:
| Q |
15 |
cagagacaaccctgcgcaatatcaaatagaactattgcatgttagaggttgaagacacccttgatttagagcgtaactaa----accctttagctaaata |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
3826160 |
cagagacaaccctgcgcaatatcaaatagaactattgcatgttagaggttgaagacacccttaatttagagcgtaactaattaaaccctttagctaaata |
3826259 |
T |
|
| Q |
111 |
agcttaaaggatcccataacccatatacaaagaatgagcttatcatttttgaagccaatcggctcaaacgcactatcgagtttatataccaatcagaaaa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3826260 |
-gcttaaaggatcccataacccatatacaaagaatgagcttatctattttgaagccaatcggctcaaacgcactatcgagtttatataccaatcagaaaa |
3826358 |
T |
|
| Q |
211 |
ataataatcaacttgtctaccctaccttaatgcgagttaggcttg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3826359 |
ataataatcaacttgtctaccctaccttaatgcgagttaggcttg |
3826403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University