View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21217_low_29 (Length: 231)
Name: NF21217_low_29
Description: NF21217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21217_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 47 - 217
Target Start/End: Complemental strand, 31733997 - 31733827
Alignment:
| Q |
47 |
cttgtattatgggacggagggggtatgttcaaaagagttaaaataattatgtaagtgtgtgggnnnnnnntgaaaaggcacgaaagaagtgtttcactgc |
146 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||||||||||||| ||| |
|
|
| T |
31733997 |
cttgtatgatgggacggagttggtatgttcaaaagagttaccataattatgtaagtgtgtgggaaaaaaatgaaaacgcacgaaagaagtgtttcagtgc |
31733898 |
T |
 |
| Q |
147 |
ttttcttagaagttagaactcagagctagaagcttcgagttggacattaattttgattttcagaagttttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31733897 |
ttttcttagaagttagaactcagagctagaagcttcgagttggacattaattttgattttcagaagttttt |
31733827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 69 - 160
Target Start/End: Original strand, 32848078 - 32848169
Alignment:
| Q |
69 |
gtatgttcaaaagagttaaaataattatgtaagtgtgtgggnnnnnnntgaaaaggcacgaaagaagtgtttcactgcttttcttagaagtt |
160 |
Q |
| |
|
||||| |||||||| ||| || || ||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32848078 |
gtatgctcaaaagaattacaacgatcatgtaagtgtgtgggacaaaaatgaaaagccacgaaagagttgtttcactgcttttcttagaagtt |
32848169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 20643948 - 20643920
Alignment:
| Q |
1 |
tgtcttttttgcttatattttgggataaa |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20643948 |
tgtcttttttgcttatattttgggataaa |
20643920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 3201300 - 3201272
Alignment:
| Q |
1 |
tgtcttttttgcttatattttgggataaa |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3201300 |
tgtcttttttgcttatattttgggataaa |
3201272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 6787218 - 6787246
Alignment:
| Q |
1 |
tgtcttttttgcttatattttgggataaa |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6787218 |
tgtcttttttgcttatattttgggataaa |
6787246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University