View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21218_low_3 (Length: 233)
Name: NF21218_low_3
Description: NF21218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21218_low_3 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 109 - 233
Target Start/End: Complemental strand, 9867306 - 9867182
Alignment:
| Q |
109 |
ttttgttccacaactgtttttgagtcccaaaacttcatatattcttttgcagttacgcttgttctataaacaatcaacaagacttggaaagcttaacaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
9867306 |
ttttgttccacaactgtttttgagtcccaaaacttcatatattcttttgcagttacacttgttctataaacaatcaacgagacttggaaagcttaacgac |
9867207 |
T |
|
| Q |
209 |
atcctgcagtgtccgtacacatttt |
233 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
9867206 |
atcctgcagtgtccgtacacatttt |
9867182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 12 - 65
Target Start/End: Complemental strand, 9867366 - 9867313
Alignment:
| Q |
12 |
aaaattttaattcaatgaactttgatattgggataagtagaaagttaataaaaa |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9867366 |
aaaattttaattcaatgaactttgatattgggataagtagaaagttaataaaaa |
9867313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University