View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2121_low_6 (Length: 238)
Name: NF2121_low_6
Description: NF2121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2121_low_6 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 33789107 - 33789328
Alignment:
| Q |
17 |
atagaggaccagaaagtttttctcccttttaccttaaatctgatttttggagtctcagtggatgtttcaagccgggggcgcttatcgtctttcttttcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33789107 |
atagaggaccagaaagtttttctcccttttaccttaaatctgatttttggagtctcagtggatgtttcaagccgggggcgcttatcgtctttcttttcat |
33789206 |
T |
|
| Q |
117 |
caactgtgactttgtcaggttgagaagtaggagctaattcagttctgataaacttttttctagctgcaatttttgctcttctagcggataaaattgtaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33789207 |
caactgtgactttgtcaggttgagaagtaggagctaattcagttctgataaacttttttctagctgcaatttttgctcttctagcggataaaattgtaga |
33789306 |
T |
|
| Q |
217 |
tccttcatccgaaattcctatt |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33789307 |
tccttcatccgaaattcctatt |
33789328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University