View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2121_low_7 (Length: 221)
Name: NF2121_low_7
Description: NF2121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2121_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 31540509 - 31540314
Alignment:
| Q |
9 |
ggtagattattcttcgatttgttttaagtggcatgcaacaccccaaatttttcagtatttataataatattctcatatgactgtcccttcttctccttga |
108 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31540509 |
ggtatatttttcttcgatttgttttaagtggcatgcaacaccccaaatttttcagtcttcataata-tattctcatatgactgtcccttcttctccttga |
31540411 |
T |
|
| Q |
109 |
tggacataaaggaaggaaaagtctccttatcaaaactttagtgggatggtaacaataatttttcatagatatttggtagaagaacggcagacacatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31540410 |
tggacataaaggaaggaaaagtctccttatcaaaactttagtgggatggtaacaataatttttcatagatatttggtagaagaagggcagacacatg |
31540314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 116 - 168
Target Start/End: Original strand, 31530816 - 31530869
Alignment:
| Q |
116 |
aaaggaaggaaaagtctccttatcaaaa-ctttagtgggatggtaacaataatt |
168 |
Q |
| |
|
|||||||| |||||||||||||| | || |||||||||||||||||||| |||| |
|
|
| T |
31530816 |
aaaggaagaaaaagtctccttattacaagctttagtgggatggtaacaacaatt |
31530869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University