View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21220_low_11 (Length: 273)
Name: NF21220_low_11
Description: NF21220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21220_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 273
Target Start/End: Complemental strand, 10463530 - 10463275
Alignment:
| Q |
18 |
catttgtagtgtcgttgatacccactcggtcacctttagtcaagtcatcgatgttgatacgactattgtgtcataacgcgatcctggggatcaattgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10463530 |
catttgtagtgtcgttgatacccactcggtcacctttagtcaagtcatcgatgttgatacgactattgtgtcataacgcgatcctggggatcaattgttg |
10463431 |
T |
|
| Q |
118 |
aactaagagctactacacagatgttgaatcttaagacattagatacaaagattttctcacttatacgctgttaaacataaactttttcatctaatgtgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10463430 |
aactaagagctactacacagatgttgaatcttaagacattagatacaaagattttctcacttatacgctgttaaacataaactttttcatctaatgtgaa |
10463331 |
T |
|
| Q |
218 |
acgtctaacgcacacttgacacaccaataactttgctttcaaacagaaaaatagaa |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10463330 |
acgtctaacgcacacttgacacaccaataactttgctttcaaacagaaaaatagaa |
10463275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University