View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21220_low_7 (Length: 332)
Name: NF21220_low_7
Description: NF21220
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21220_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 15 - 316
Target Start/End: Complemental strand, 39704032 - 39703735
Alignment:
| Q |
15 |
tatctgagctgatacggtaggtgctagtaagtagtaacccaggtgtatgaaagaaattgaaaaggggatgcaatgtagggaaccatgcatattcaagaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39704032 |
tatctgagctgatacggtaggtgctagtaagtagtaacccaggtgtatgaaagaaattgaaaaggggatgcaatgtagggaaccat----attcaagaga |
39703937 |
T |
 |
| Q |
115 |
gagtataatgcaatagaggattgtggataatagcagaacgccaaaattctgcaataatttcacaaaataatttacataacaaagattaatcaacaaaata |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39703936 |
gagtataatgcaatagagtattgtggataatagcagaacgccaaaattctgcaataatttcacaaaataatttacataacaaagattaatcaacaaaata |
39703837 |
T |
 |
| Q |
215 |
taactttatatttcatgacacgaattcaactaatcaaatcatctctagctttatatttatcatctgcgaaaatgtatttcattgtatcaacttcatttca |
314 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39703836 |
taattttatatttcatgacacgaattcaattaatcaaatcatctctaactttatatttatcatctgcgaaaatgtatttcattgtatcaacttcatttca |
39703737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University